Skip to main content
Addgene

pLenti_CMVTRE3G_LYSET-Isoform1_I142V-Puro
(Plasmid #192004)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192004 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti CMVTRE3G Puro DEST (w811-1)
  • Backbone manufacturer
    addgene #27565
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LYSET-Isoform1 I142V
  • Species
    H. sapiens (human)
  • Entrez Gene
    LYSET (a.k.a. C14orf109, DMAN, GCAF, TMEM251)
  • Promoter CMVTRE3G

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAACCGTCAGATCGCCTGG
  • 3′ sequencing primer CATTAAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti_CMVTRE3G_LYSET-Isoform1_I142V-Puro was a gift from Jan Carette (Addgene plasmid # 192004 ; http://n2t.net/addgene:192004 ; RRID:Addgene_192004)
  • For your References section:

    The human disease gene LYSET is essential for lysosomal enzyme transport and viral infection. Richards CM, Jabs S, Qiao W, Varanese LD, Schweizer M, Mosen PR, Riley NM, Klussendorf M, Zengel JR, Flynn RA, Rustagi A, Widen JC, Peters CE, Ooi YS, Xie X, Shi PY, Bartenschlager R, Puschnik AS, Bogyo M, Bertozzi CR, Blish CA, Winter D, Nagamine CM, Braulke T, Carette JE. Science. 2022 Sep 8:eabn5648. doi: 10.1126/science.abn5648. 10.1126/science.abn5648 PubMed 36074821