pLenti_CMVTRE3G_LYSET-Isoform1_untagged-Puro
(Plasmid
#192001)
-
PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 stable expressing cell line under CMVTRE3G promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 192001 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti CMVTRE3G Puro DEST (w811-1)
-
Backbone manufactureraddgene #27565
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameLYSET-Isoform1
-
SpeciesH. sapiens (human)
-
Entrez GeneLYSET (a.k.a. C14orf109, DMAN, GCAF, TMEM251)
- Promoter CMVTRE3G
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAACCGTCAGATCGCCTGG
- 3′ sequencing primer CATTAAAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti_CMVTRE3G_LYSET-Isoform1_untagged-Puro was a gift from Jan Carette (Addgene plasmid # 192001 ; http://n2t.net/addgene:192001 ; RRID:Addgene_192001) -
For your References section:
The human disease gene LYSET is essential for lysosomal enzyme transport and viral infection. Richards CM, Jabs S, Qiao W, Varanese LD, Schweizer M, Mosen PR, Riley NM, Klussendorf M, Zengel JR, Flynn RA, Rustagi A, Widen JC, Peters CE, Ooi YS, Xie X, Shi PY, Bartenschlager R, Puschnik AS, Bogyo M, Bertozzi CR, Blish CA, Winter D, Nagamine CM, Braulke T, Carette JE. Science. 2022 Sep 8:eabn5648. doi: 10.1126/science.abn5648. 10.1126/science.abn5648 PubMed 36074821