Skip to main content
Addgene

pET28 acid.4
(Plasmid #191898)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191898 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pET28
  • Backbone size w/o insert (bp) 5209
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    acid.4
  • Species
    Aequorea victoria
  • Insert Size (bp)
    747
  • Mutation
    V61L Q69L Y145M L220V
  • Promoter T7
  • Tag / Fusion Protein
    • His Tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer gctagttattgctcagcgg
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Design created by the htFuncLib algorithm

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28 acid.4 was a gift from Sarel Fleishman (Addgene plasmid # 191898 ; http://n2t.net/addgene:191898 ; RRID:Addgene_191898)

  • For your References section:

    Designed active-site library reveals thousands of functional GFP variants. Weinstein JY, Marti-Gomez C, Lipsh-Sokolik R, Hoch SY, Liebermann D, Nevo R, Weissman H, Petrovich-Kopitman E, Margulies D, Ivankov D, McCandlish DM, Fleishman SJ. Nat Commun. 2023 May 20;14(1):2890. doi: 10.1038/s41467-023-38099-z. 10.1038/s41467-023-38099-z PubMed 37210560
Related items: