Skip to main content
Addgene

pcDNA3.1-Hyg-mEGFP
(Plasmid #191847)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191847 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1-(-)-Hyg
  • Backbone manufacturer
    Thermofisher scientific
  • Backbone size w/o insert (bp) 5596
  • Total vector size (bp) 6293
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEGFP
  • Species
    Synthetic
  • Insert Size (bp)
    810
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site EcoRV (not destroyed)
  • 5′ sequencing primer GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer GGCAACTAGAAGGCACAGTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Additional References:
Chaumont L, Jouneau L, Huetz F, van Muilekom DR, Peruzzi M, Raffy C, Le Hir J, Minke J, Boudinot P, Collet B. Unexpected regulatory functions of cyprinid Viperin on inflammation and metabolism. BMC Genomics. 2024 Jun 29;25(1):650. doi: 10.1186/s12864-024-10566-x. PMID: 38951796; PMCID: PMC11218377.

Chaumont, L., Peruzzi, M., Huetz, F., Raffy, C., Le Hir, J., Minke, J., Boudinot, P., Collet, B., 2024. Salmonid Double-stranded RNA–Dependent Protein Kinase Activates Apoptosis and Inhibits Protein Synthesis. J. Immunol. https://doi.org/10.4049/JIMMUNOL.2400076 PMID: 39058317

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-Hyg-mEGFP was a gift from Bertrand Collet (Addgene plasmid # 191847 ; http://n2t.net/addgene:191847 ; RRID:Addgene_191847)

  • For your References section:

    Detection of Salmonid IgM Specific to the Piscine Orthoreovirus Outer Capsid Spike Protein Sigma 1 Using Lipid-Modified Antigens in a Bead-Based Antibody Detection Assay. Teige LH, Kumar S, Johansen GM, Wessel O, Vendramin N, Lund M, Rimstad E, Boysen P, Dahle MK. Front Immunol. 2019 Sep 6;10:2119. doi: 10.3389/fimmu.2019.02119. eCollection 2019. 10.3389/fimmu.2019.02119 PubMed 31552049
Related items:
Commonly requested with: