pcDNA3.1-Hyg-mEGFP
(Plasmid #191847)

• Purpose: Expresses the monomeric form of EGFP
• Depositing Lab: Bertrand Collet
• Publication: Teige et al Front Immunol. 2019 Sep 6;10:2119. doi: 10.3389/fimmu.2019.02119. eCollection 2019.

Backbone

• Vector backbone: pcDNA3.1-(-)-Hyg
• Backbone manufacturer: Thermofisher scientific
• Backbone size w/o insert (bp): 5596
• Total vector size (bp): 6293
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mEGFP
• Species: Synthetic
• Insert Size (bp): 810
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: GGCTAACTAGAGAACCCACTG
• 3′ sequencing primer: GGCAACTAGAAGGCACAGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Additional Reference: Chaumont L, Jouneau L, Huetz F, van Muilekom DR, Peruzzi M, Raffy C, Le Hir J, Minke J, Boudinot P, Collet B. Unexpected regulatory functions of cyprinid Viperin on inflammation and metabolism. BMC Genomics. 2024 Jun 29;25(1):650. doi: 10.1186/s12864-024-10566-x. PMID: 38951796; PMCID: PMC11218377.