pcDNA3.1-Hyg-mEGFP-pp4640
(Plasmid
#191846)
-
PurposeExpresses Salmon Alphavirus polyprotein with mEGFP N-terminal fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191846 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1-(-)-Hyg
-
Backbone manufacturerThermofisher scientific
- Backbone size w/o insert (bp) 5596
- Total vector size (bp) 11165
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemEGFP-pp4640
-
SpeciesSynthetic; Salmon alphavirus
-
Insert Size (bp)3945
-
MutationmEGFP fusion in Nterminal, some silent point mutation to remove restriction sites
- Promoter CMV
-
Tag
/ Fusion Protein
- mEGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer pcDNA3_for: GGCTAACTAGAGAACCCACTG
- 3′ sequencing primer pcDNA3_rev: GGCAACTAGAAGGCACAGTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Hyg-mEGFP-pp4640 was a gift from Bertrand Collet (Addgene plasmid # 191846 ; http://n2t.net/addgene:191846 ; RRID:Addgene_191846) -
For your References section:
Detection of Salmonid IgM Specific to the Piscine Orthoreovirus Outer Capsid Spike Protein Sigma 1 Using Lipid-Modified Antigens in a Bead-Based Antibody Detection Assay. Teige LH, Kumar S, Johansen GM, Wessel O, Vendramin N, Lund M, Rimstad E, Boysen P, Dahle MK. Front Immunol. 2019 Sep 6;10:2119. doi: 10.3389/fimmu.2019.02119. eCollection 2019. 10.3389/fimmu.2019.02119 PubMed 31552049