Skip to main content
Addgene

pcDNA3.1-Hyg-mEGFP-pp4640
(Plasmid #191846)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191846 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1-(-)-Hyg
  • Backbone manufacturer
    Thermofisher scientific
  • Backbone size w/o insert (bp) 5596
  • Total vector size (bp) 11165
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mEGFP-pp4640
  • Species
    Synthetic; Salmon alphavirus
  • Insert Size (bp)
    3945
  • Mutation
    mEGFP fusion in Nterminal, some silent point mutation to remove restriction sites
  • Promoter CMV
  • Tag / Fusion Protein
    • mEGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site PmeI (not destroyed)
  • 5′ sequencing primer pcDNA3_for: GGCTAACTAGAGAACCCACTG
  • 3′ sequencing primer pcDNA3_rev: GGCAACTAGAAGGCACAGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-Hyg-mEGFP-pp4640 was a gift from Bertrand Collet (Addgene plasmid # 191846 ; http://n2t.net/addgene:191846 ; RRID:Addgene_191846)
  • For your References section:

    Detection of Salmonid IgM Specific to the Piscine Orthoreovirus Outer Capsid Spike Protein Sigma 1 Using Lipid-Modified Antigens in a Bead-Based Antibody Detection Assay. Teige LH, Kumar S, Johansen GM, Wessel O, Vendramin N, Lund M, Rimstad E, Boysen P, Dahle MK. Front Immunol. 2019 Sep 6;10:2119. doi: 10.3389/fimmu.2019.02119. eCollection 2019. 10.3389/fimmu.2019.02119 PubMed 31552049