pUS252y
(Plasmid #191834)

• Purpose: Expresses fuYFP constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuYFP to place in other plasmid backbones.
• Depositing Lab: Nicholas Coleman
• Publication: A new open-source superfolding green fluorescent protein: Free-Use GFP (fuGFP) (unpublished)

Backbone

• Vector backbone: pK18
• Backbone size w/o insert (bp): 2633
• Total vector size (bp): 3356
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: fuYFP
• Species: Synthetic
• Insert Size (bp): 726

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI, EcoRI, XbaI, XhoI (unknown if destroyed)
• 3′ cloning site: HindIII, PstI, SphI (unknown if destroyed)
• 5′ sequencing primer: CTTCCGGCTCGTATGTTGTG
• 3′ sequencing primer: GCAAGGCGATTAAGTTGGGTAACG

Resource Information

• Supplemental Documents:
  • pUS252y.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

fuYFP is an open-source superfolding yellow fluorescent protein with excitation maximum at 514 nm and emission maximum at 529 nm. Relative to the original fuGFP, the protein contains the S65G and T203Y mutations (amino acid numbering based on classical GFP).