pUS252b
(Plasmid #191831)

• Purpose: Expresses fuGFPb constitutively in E.coli cells. Designed to act as modular template for cutting out or amplifying fuGFPb to place in other plasmid backbones
• Depositing Lab: Nicholas Coleman
• Publication: A new open-source superfolding green fluorescent protein: Free-Use GFP (fuGFP) (unpublished)

Backbone

• Vector backbone: pK18
• Backbone size w/o insert (bp): 2633
• Total vector size (bp): 3356
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: fuGFPb
• Species: Synthetic
• Insert Size (bp): 726

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI, EcoRI, XbaI, XhoI (unknown if destroyed)
• 3′ cloning site: HindIII, PstI, SphI (unknown if destroyed)
• 5′ sequencing primer: CTTCCGGCTCGTATGTTGTG
• 3′ sequencing primer: GCAAGGCGATTAAGTTGGGTAACG

Resource Information

• Supplemental Documents:
  • pUS252b.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA

Depositor Comments

fuGFPb is an open-source superfolding green fluorescent protein with excitation maximum at 485 nm and emission maximum at 510 nm. Relative to the original fuGFP, the protein contains the S65T and P211Q mutations, which increase its absorption of blue light (amino acid numbering based on classical GFP).