Skip to main content
Addgene

pBK-CMV-mpx
(Plasmid #191826)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191826 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pBK-CMV
  • Backbone size w/o insert (bp) 4500
  • Total vector size (bp) 7625
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mpx cDNA
  • Alt name
    myeloperoxidase
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    3108
  • Entrez Gene
    mpx (a.k.a. drf, fj80f04, mpo, wu:fj80f04)
  • Promoter CMV promoter

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gtaaaacgacggccagt
  • 3′ sequencing primer agcggataacaatttcacacagg
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBK-CMV-mpx was a gift from Jason Berman (Addgene plasmid # 191826 ; http://n2t.net/addgene:191826 ; RRID:Addgene_191826)

  • For your References section:

    Human JAK1 gain of function causes dysregulated myelopoeisis and severe allergic inflammation. Biggs CM, Cordeiro-Santanach A, Prykhozhij SV, Deveau AP, Lin Y, Del Bel KL, Orben F, Ragotte RJ, Saferali A, Mostafavi S, Dinh L, Dai D, Weinacht KG, Dobbs K, Ott de Bruin L, Sharma M, Tsai K, Priatel JJ, Schreiber RA, Rozmus J, Hosking MC, Shopsowitz KE, McKinnon ML, Vercauteren S, Seear M, Notarangelo LD, Lynn FC, Berman JN, Turvey SE. JCI Insight. 2022 Dec 22;7(24):e150849. doi: 10.1172/jci.insight.150849. 10.1172/jci.insight.150849 PubMed 36546480
Related items: