Addgene: EGFP-p300 (D1399Y) Skip to main content
Addgene

EGFP-p300 (D1399Y)
(Plasmid #191763)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191763 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pIRESpuro2
  • Backbone size w/o insert (bp) 4844
  • Total vector size (bp) 7751
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FRB-EGFP-p300 core (D1399Y)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2907
  • Mutation
    catalytic D1399Y mutation in p300
  • GenBank ID
    NM_001429
  • Entrez Gene
    EP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
  • Promoter EF1alpha
  • Tags / Fusion Proteins
    • EGFP (N-terminal of p300 core (D1399Y)) (N terminal on insert)
    • FRB (N-terminal of EGFP) (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAAGTGCAGTAGTCGCCGTGAACGT
  • 3′ sequencing primer CATGCCCGCTTTTGAGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP-p300 (D1399Y) was a gift from Daniel Gerlich (Addgene plasmid # 191763 ; http://n2t.net/addgene:191763 ; RRID:Addgene_191763)
  • For your References section:

    A mitotic chromatin phase transition prevents perforation by microtubules. Schneider MWG, Gibson BA, Otsuka S, Spicer MFD, Petrovic M, Blaukopf C, Langer CCH, Batty P, Nagaraju T, Doolittle LK, Rosen MK, Gerlich DW. Nature. 2022 Sep;609(7925):183-190. doi: 10.1038/s41586-022-05027-y. Epub 2022 Aug 3. 10.1038/s41586-022-05027-y PubMed 35922507