pCRISPomyces-AsCas12j-2
(Plasmid
#191655)
-
PurposeAll-in-one editing CRISPR-Cas construct for one-step genome editing of Streptomyces using AsCas12j-2
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCRISPomyces-2
- Backbone size w/o insert (bp) 6888
- Total vector size (bp) 9159
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAsCas12j-2
-
Alt nameCasΦ-2
-
Alt nameCas12j2
-
SpeciesAcidaminococcus sp.
-
Insert Size (bp)2274
- Promoter rpsL(XC)-BbsI
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccgtgagctcgagtagacgacggagacgtaatgccc
- 3′ sequencing primer ttttgcggggaacgcgtagatctgaattctcagctggtc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPomyces-AsCas12j-2 was a gift from Fong Tian Wong (Addgene plasmid # 191655 ; http://n2t.net/addgene:191655 ; RRID:Addgene_191655) -
For your References section:
Application of Cas12j for Streptomyces editing and cluster activation. Tan LL, Heng E, Zulkarnain N, Leong CY, Ng V, Yang LK, San Seow DC, Peh G, Lim YH, Lokanand K, Kanagasundaram YH, Ng SB, Wong FT. bioRxiv 2021.10.28.465406 10.1101/2021.10.28.465406