pTFG005_Spike_Inducible_3xFlag
(Plasmid #191578)

• Purpose: Inducible expression of SARS-CoV-2 Spike protein with C-terminal 3x FLAG tag under TRE3G promoter and cloned into a 2nd generation lentiviral transfer plasmid (modified pLVX with Hygro resistance).
• Depositing Lab: Joshua Leonard
• Publication: Gunnels et al Small. 2022 May;18(19):e2200125. doi: 10.1002/smll.202200125. Epub 2022 Apr 7.

Backbone

• Vector backbone: pLVX-TRE3G
• Backbone manufacturer: Clontech (Takara)
• Modifications to backbone: HygroR instead of PuroR.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS-CoV-2 Spike Protein
• Alt name: Spike
• Species: Synthetic
• Insert Size (bp): 3819
• GenBank ID: 43740568
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: TRE3G
• Tag / Fusion Protein:
  • 3x FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: MluI (unknown if destroyed)
• 5′ sequencing primer: gcctggagcaattccacaacac

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Fang Li's lab. Spike sequence cloned from Addgene plasmid #145032.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry