pDMS151A_Tet-On-3G
(Plasmid #191577)

• Purpose: ClonTech-Takara's doxycycline-inducible, rtTA transactivator (Tet-On-3G) cloned into a 2nd generation lentiviral transfer plasmid (pGIPZ).
• Depositing Lab: Joshua Leonard
• Publication: Gunnels et al Small. 2022 May;18(19):e2200125. doi: 10.1002/smll.202200125. Epub 2022 Apr 7.

Backbone

• Vector backbone: pGIPZ
• Backbone manufacturer: Open Biosystems
• Total vector size (bp): 10533
• Modifications to backbone: C-terminus of insert: P2A self cleaving tag and BlastR gene.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Hygromycin, Blasticidin ; HygroR is in plasmid backbone. BlastR is between LTRs and is packaged into lentivirus.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tet-On(R) 3G
• Alt name: rtTA
• Species: Synthetic
• Insert Size (bp): 744
• GenBank ID:
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg

Resource Information

• Supplemental Documents:
  • pDMS151A_Tet-On-3G.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry