Skip to main content
Addgene

pTFG011_Spike_Parental_D614G_3xFlag
(Plasmid #191571)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191571 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1/Hygro(+)
  • Backbone manufacturer
    Thermo Fisher
  • Backbone size w/o insert (bp) 4305
  • Modifications to backbone
    1. Beta-globin intron added. 2. See Addgene #138749. Deliberately modified from pcDNA3.1/HygroR(+) in the following ways: SV40 Promoter deleted (but SV40 origin retained), HygroR gene deleted, BsaI site in AmpR mutated, BpiI site in BGH PolyA tail mutated.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 Spike Protein
  • Alt name
    Spike
  • Species
    Synthetic
  • Insert Size (bp)
    3762
  • Mutation
    D614G mutation. Last 19 amino acids truncated.
  • GenBank ID
    43740568
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter CMV
  • Tag / Fusion Protein
    • 3x FLAG (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gctaatagcagctacaatccagctacc
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Fang Li's lab. Nonmutated Spike sequence cloned from Addgene plasmid #145032.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTFG011_Spike_Parental_D614G_3xFlag was a gift from Joshua Leonard (Addgene plasmid # 191571 ; http://n2t.net/addgene:191571 ; RRID:Addgene_191571)

  • For your References section:

    Elucidating Design Principles for Engineering Cell-Derived Vesicles to Inhibit SARS-CoV-2 Infection. Gunnels TF, Stranford DM, Mitrut RE, Kamat NP, Leonard JN. Small. 2022 May;18(19):e2200125. doi: 10.1002/smll.202200125. Epub 2022 Apr 7. 10.1002/smll.202200125 PubMed 35388947
Related items: