pTFG011_Spike_Parental_D614G_3xFlag
(Plasmid #191571)

• Purpose: SARS-CoV-2 Spike protein under CMV with D614G, C-term 19 amino acid truncation, and 3x FLAG. For expression and pseudotyping lentiviral particles.
• Depositing Lab: Joshua Leonard
• Publication: Gunnels et al Small. 2022 May;18(19):e2200125. doi: 10.1002/smll.202200125. Epub 2022 Apr 7.

Backbone

• Vector backbone: pcDNA3.1/Hygro(+)
• Backbone manufacturer: Thermo Fisher
• Backbone size w/o insert (bp): 4305
• Modifications to backbone: 1. Beta-globin intron added. 2. See Addgene #138749. Deliberately modified from pcDNA3.1/HygroR(+) in the following ways: SV40 Promoter deleted (but SV40 origin retained), HygroR gene deleted, BsaI site in AmpR mutated, BpiI site in BGH PolyA tail mutated.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SARS-CoV-2 Spike Protein
• Alt name: Spike
• Species: Synthetic
• Insert Size (bp): 3762
• Mutation: D614G mutation. Last 19 amino acids truncated.
• GenBank ID: 43740568
• Entrez Gene: S (a.k.a. GU280_gp02, spike glycoprotein)
• Promoter: CMV
• Tag / Fusion Protein:
  • 3x FLAG (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: gctaatagcagctacaatccagctacc

Resource Information

• Supplemental Documents:
  • pTFG011-Spike-Parental_D614G_3xFlag.gbk
• A portion of this plasmid was derived from a plasmid made by: Fang Li's lab. Nonmutated Spike sequence cloned from Addgene plasmid #145032.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry