pTFG002-ACE2(Mut)-HA
(Plasmid #191570)

• Purpose: ACE2 insert in a 2nd generation lentiviral transfer plasmid (pGIPZ) to generate ACE2(Mut)-expressing cells. Codon-optimized for human expression. Insert contains C-terminal HA Tag.
• Depositing Lab: Joshua Leonard
• Publication: Gunnels et al Small. 2022 May;18(19):e2200125. doi: 10.1002/smll.202200125. Epub 2022 Apr 7.

Backbone

• Vector backbone: pGIPZ
• Backbone manufacturer: Open Biosystems
• Backbone size w/o insert (bp): 10721
• Total vector size (bp): 13172
• Modifications to backbone: shRNA deleted; AscI and BsrGI restriction enzyme site deleted.
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Angiotensin Converting Enzyme II
• Species: H. sapiens (human)
• Insert Size (bp): 2415
• Mutation: Codon-optimized for human expression. Also contains H34A, T92Q, Q325P, A386L.
• GenBank ID: NP_001358344.1
• Entrez Gene: ACE2 (a.k.a. ACEH)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: CCTCACATTGCCAAAAGACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Mutated ACE2 sequence originally reported in the following publication: Chan, Kui K., et al. "Engineering human ACE2 to optimize binding to the spike protein of SARS coronavirus 2." Science 369.6508 (2020): 1261-1265.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

In the associated publication for this Addgene plasmid, this construct is referred to as: pTFG002_ACE2_mutant_HA.