Skip to main content
Addgene

pTFG001-ACE2(WT)-HA
(Plasmid #191569)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191569 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pGIPZ
  • Backbone manufacturer
    Open Biosystems
  • Backbone size w/o insert (bp) 10721
  • Total vector size (bp) 13172
  • Modifications to backbone
    shRNA deleted; AscI and BsrGI restriction enzyme site deleted.
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Angiotensin Converting Enzyme II
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2415
  • Mutation
    Codon optimized for expression in human cells
  • GenBank ID
    NP_001358344
  • Entrez Gene
    ACE2 (a.k.a. ACEH)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

In the associated publication for this Addgene plasmid, this construct is referred to as: pTFG001_ACE2_wt_HA.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTFG001-ACE2(WT)-HA was a gift from Joshua Leonard (Addgene plasmid # 191569 ; http://n2t.net/addgene:191569 ; RRID:Addgene_191569)

  • For your References section:

    Elucidating Design Principles for Engineering Cell-Derived Vesicles to Inhibit SARS-CoV-2 Infection. Gunnels TF, Stranford DM, Mitrut RE, Kamat NP, Leonard JN. Small. 2022 May;18(19):e2200125. doi: 10.1002/smll.202200125. Epub 2022 Apr 7. 10.1002/smll.202200125 PubMed 35388947
Related items: