Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

eSpCas9(1.1)_NoFlag_ATP1A1_G3_SLBP_G1_Dual_sgRNA
(Plasmid #191528)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191528 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA (Plasmid #86613)
  • Backbone size w/o insert (bp) 8858
  • Total vector size (bp) 8860
  • Vector type
    Mammalian Expression, CRISPR ; Co-selection via HDR using ouabain

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLBP 3'UTR G1 sgRNA + ATP1A1 G3 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • GenBank ID

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

-ATP1A1 G3 gRNA target sequence is GAGTTCTGTAATTCAGCATA

-SLBP G1 gRNA target sequence is GTGAGCTAACTGCCCCCTGG (1st base "A" is mismatched/replaced by "G").

-Use in combination with hSLBP_mNG_FS_Donor (Plasmid #191387)

-See Marker-free coselection for CRISPR-driven genome editing in human cells. Agudelo D, Duringer A, Bozoyan L, Huard CC, Carter S, Loehr J, Synodinou D, Drouin M, Salsman J, Dellaire G, Laganiere J, Doyon Y. Nat Methods. 2017 Apr 17. doi: 10.1038/nmeth.4265. 10.1038/nmeth.4265 PubMed 28417998

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    eSpCas9(1.1)_NoFlag_ATP1A1_G3_SLBP_G1_Dual_sgRNA was a gift from Yannick Doyon (Addgene plasmid # 191528 ; http://n2t.net/addgene:191528 ; RRID:Addgene_191528)