Skip to main content
Addgene

pL8N_RB610-HBB_X1
(Plasmid #191521)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191521 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pL8N
  • Total vector size (bp) 6009
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ZF-DdCBE RB610-HBB X1
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atggtgatgcggttttggcagtacatcaat
  • 3′ sequencing primer tgaataatcaaacaaaaattatccaggacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL8N_RB610-HBB_X1 was a gift from David Liu (Addgene plasmid # 191521 ; http://n2t.net/addgene:191521 ; RRID:Addgene_191521)
  • For your References section:

    Compact zinc finger base editors that edit mitochondrial or nuclear DNA in vitro and in vivo. Willis JCW, Silva-Pinheiro P, Widdup L, Minczuk M, Liu DR. Nat Commun. 2022 Nov 23;13(1):7204. doi: 10.1038/s41467-022-34784-7. 10.1038/s41467-022-34784-7 PubMed 36418298