pL8_3xG34-DCAF8L2_X1
(Plasmid #191519)

• Purpose: Expression of nuclear v8 ZF-DdCBE in mammalian cells (C-terminal DddAC, Right)
• Depositing Lab: David Liu
• Publication: Willis et al Nat Commun. 2022 Nov 23;13(1):7204. doi: 10.1038/s41467-022-34784-7.

Backbone

• Vector backbone: pL8
• Total vector size (bp): 5727
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZF-DdCBE 3xG34-DCAF8L2 X1
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atggtgatgcggttttggcagtacatcaat
• 3′ sequencing primer: tattggaaaccttaaatactgttcagaaaga

Resource Information

• Supplemental Documents:
  • pL8_3xG34-DCAF8L2_X1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a 2nt deletion causing frameshift changing last 6 amino acids and adding 38 amino acids to the C-terminus of the Blasticidin resistance gene. These differences are not known to affect plasmid function.