Skip to main content
Addgene

pCDH-EFS-FlpO
(Plasmid #191509)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191509 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCDH
  • Total vector size (bp) 7437
  • Modifications to backbone
    EFS promoter driving FlpO expression
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    flp recombinase
  • Alt name
    EFS promoter driving FlpO recombinase
  • Insert Size (bp)
    212
  • Entrez Gene
    flp
  • Promoter EF1a/EFS promoter inserted

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SnaI (destroyed during cloning)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ccagtacatgaccttatggg
  • 3′ sequencing primer GATGTCGAACTGGCTCAT
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    We replaced the CMV promoter from pCDH-CMV-FlpO (Camolotto et al 2018) with an EF1a/EFS promoter from the pCDH-Cre plasmid (Han et al 2014)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDH-EFS-FlpO was a gift from Eric Snyder (Addgene plasmid # 191509 ; http://n2t.net/addgene:191509 ; RRID:Addgene_191509)

  • For your References section:

    FoxA1 and FoxA2 control growth and cellular identity in NKX2-1-positive lung adenocarcinoma. Orstad G, Fort G, Parnell TJ, Jones A, Stubben C, Lohman B, Gillis KL, Orellana W, Tariq R, Klingbeil O, Kaestner K, Vakoc CR, Spike BT, Snyder EL. Dev Cell. 2022 Aug 8;57(15):1866-1882.e10. doi: 10.1016/j.devcel.2022.06.017. Epub 2022 Jul 13. 10.1016/j.devcel.2022.06.017 PubMed 35835117
Related items:
Commonly requested with: