pJH3666
(Plasmid
#191447)
-
PurposePacr-2s-GCaMP6s::wCherry unc-54 3' UTR C.elegans A/B MN expression of GCaMP6s RFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBSK
-
Backbone manufacturerstratagene
- Backbone size w/o insert (bp) 6479
- Total vector size (bp) 7982
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCaMP6s
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1503
- Promoter Pacr-2s
-
Tag
/ Fusion Protein
- wCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer AAAAATGGGATCTCACCACCACCACCACC
- 3′ sequencing primer CTCCCTTGGCGGTCATCATCTGGACGAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH3666 was a gift from Mei Zhen (Addgene plasmid # 191447 ; http://n2t.net/addgene:191447 ; RRID:Addgene_191447) -
For your References section:
Extrasynaptic signaling enables an asymmetric juvenile motor circuit to produce symmetric undulation. Lu Y, Ahamed T, Mulcahy B, Meng J, Witvliet D, Guan SA, Holmyard D, Hung W, Wen Q, Chisholm AD, Samuel ADT, Zhen M. Curr Biol. 2022 Nov 7;32(21):4631-4644.e5. doi: 10.1016/j.cub.2022.09.002. Epub 2022 Sep 30. 10.1016/j.cub.2022.09.002 PubMed 36182701