hTln1-R12DD-SCLS
(Plasmid
#191443)
-
Purposeexpresses a variant of human talin1 domains R12-DD, with a deletion between K2375 and A2397
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191443 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET151
- Backbone size w/o insert (bp) 5658
- Total vector size (bp) 6912
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman Talin1 R12DD
-
Alt namehTln1-R12DD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1254
-
Mutationdeletion between residues K2375 and A2397
-
GenBank IDNC_000009.12
-
Entrez GeneTLN1 (a.k.a. ILWEQ, TLN, talin-1)
-
Tag
/ Fusion Protein
- His-tag, TEV cleavage site (N terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.10.17.22280833 for medRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hTln1-R12DD-SCLS was a gift from Ben Goult (Addgene plasmid # 191443 ; http://n2t.net/addgene:191443 ; RRID:Addgene_191443) -
For your References section:
Talin1 dysfunction is genetically linked to systemic capillary leak syndrome. Elefant N, Rouni G, Arapatzi C, Oz-Levi D, Sion-Sarid R, Edwards WJ, Ball NJ, Yanovsky-Dagan S, Cowell AR, Meiner V, Vainstein V, Grammenoudi S, Lancet D, Goult BT, Harel T, Kostourou V. JCI Insight. 2024 Dec 20;9(24):e173664. doi: 10.1172/jci.insight.173664. 10.1172/jci.insight.173664 PubMed 39704176