eSpCas9(1.1)_NoFlag_hROSA26_Left
(Plasmid
#191442)
-
PurposeExpresses the hROSA26 left sgRNA in combination with FLAGless eSpCas9(1.1) to target the hRosa26 safe harbor locus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneeSpCas9(1.1)_No_FLAG (Plasmid #79877)
- Backbone size w/o insert (bp) 8437
- Total vector size (bp) 8439
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehROSA26 sgRNA
-
SpeciesH. sapiens (human)
-
Insert Size (bp)20
- Promoter CBh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer GAGGGCCTATTTCCCATGATT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
-hROSA26 guide sequence (aka gRNA- L) is GTCGAGTCGCTTCTCGATTA see PMID: 27899508
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eSpCas9(1.1)_NoFlag_hROSA26_Left was a gift from Yannick Doyon (Addgene plasmid # 191442 ; http://n2t.net/addgene:191442 ; RRID:Addgene_191442)