hTln1-R1R2
(Plasmid
#191440)
-
PurposeExpresses the human TLN1 R1R2 domains in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191440 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET151
- Backbone size w/o insert (bp) 5658
- Total vector size (bp) 6687
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman Talin1 R1R2 domains
-
Alt namehTln1-R1R2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1029
-
GenBank IDNC_000009.12
-
Entrez GeneTLN1 (a.k.a. ILWEQ, TLN, talin-1)
-
Tag
/ Fusion Protein
- His-tag, TEV cleavage site (N terminal on backbone)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hTln1-R1R2 was a gift from Ben Goult (Addgene plasmid # 191440 ; http://n2t.net/addgene:191440 ; RRID:Addgene_191440) -
For your References section:
TLN1 contains a cancer-associated cassette exon that alters talin-1 mechanosensitivity. Gallego-Paez LM, Edwards WJS, Chanduri M, Guo Y, Koorman T, Lee CY, Grexa N, Derksen P, Yan J, Schwartz MA, Mauer J, Goult BT. J Cell Biol. 2023 May 1;222(5):e202209010. doi: 10.1083/jcb.202209010. Epub 2023 Mar 6. 10.1083/jcb.202209010 PubMed 36880935