Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hTln1-R1R2-17b
(Plasmid #191427)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 191427 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET151
  • Backbone size w/o insert (bp) 5658
  • Total vector size (bp) 6738
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human Talin1 R1R2 domains
  • Alt name
    hTln1-R1R2-17b
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1080
  • Mutation
    contains 17AA insertion from inclusion of exon 17b
  • GenBank ID
    NC_000009.12
  • Entrez Gene
    TLN1 (a.k.a. ILWEQ, TLN, talin-1)
  • Tag / Fusion Protein
    • His-tag, TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method TOPO Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hTln1-R1R2-17b was a gift from Ben Goult (Addgene plasmid # 191427 ; http://n2t.net/addgene:191427 ; RRID:Addgene_191427)
  • For your References section:

    TLN1 contains a cancer-associated cassette exon that alters talin-1 mechanosensitivity. Gallego-Paez LM, Edwards WJS, Chanduri M, Guo Y, Koorman T, Lee CY, Grexa N, Derksen P, Yan J, Schwartz MA, Mauer J, Goult BT. J Cell Biol. 2023 May 1;222(5):e202209010. doi: 10.1083/jcb.202209010. Epub 2023 Mar 6. 10.1083/jcb.202209010 PubMed 36880935