Venus-Bik-del72-136-pEGFP-C3
(Plasmid
#191411)
-
PurposeTransfection of this plasmid will express "VBik-d72-136" (Venus fused to the N-terminus of the BH3-only protein, Bik that has amino acids 72-136 deleted).
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBcl-2-interacting killer
-
Alt nameApoptosis inducer NBK
-
SpeciesH. sapiens (human)
-
Mutationwith deletion of amino acids 72-136 (del72-136) in BIK coding sequence. See original Addgene plasmid# 166737. We created primers to delete the amino acids 72-136, leaving a short linker within this site joining the BH3 region to the membrane binding region of BIK protein.
-
GenBank IDNM_001197.5
-
Entrez GeneBIK (a.k.a. BIP1, BP4, NBK)
- Promoter CMV
-
Tag
/ Fusion Protein
- Venus (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGACGCAAATGGGCGGTAGG
- 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Venus-Bik-del72-136-pEGFP-C3 was a gift from David Andrews (Addgene plasmid # 191411 ; http://n2t.net/addgene:191411 ; RRID:Addgene_191411)