Skip to main content
Addgene

Venus-Bik-del72-136-pEGFP-C3
(Plasmid #191411)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191411 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bcl-2-interacting killer
  • Alt name
    Apoptosis inducer NBK
  • Species
    H. sapiens (human)
  • Mutation
    with deletion of amino acids 72-136 (del72-136) in BIK coding sequence. See original Addgene plasmid# 166737. We created primers to delete the amino acids 72-136, leaving a short linker within this site joining the BH3 region to the membrane binding region of BIK protein.
  • GenBank ID
    NM_001197.5
  • Entrez Gene
    BIK (a.k.a. BIP1, BP4, NBK)
  • Promoter CMV
  • Tag / Fusion Protein
    • Venus (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TGACGCAAATGGGCGGTAGG
  • 3′ sequencing primer TCGCCCTTTGACGTTGGAGTCCAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Venus-Bik-del72-136-pEGFP-C3 was a gift from David Andrews (Addgene plasmid # 191411 ; http://n2t.net/addgene:191411 ; RRID:Addgene_191411)
Related items: