Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSIN-U6-tracer_C9_1_-EF1a-Thy1.1-P2A-Neo
(Plasmid #191397)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191397 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSIN-U6-tracer_sgRNA_-EF1a-Thy1.1-P2A-Neo
  • Backbone size w/o insert (bp) 7100
  • Total vector size (bp) 7106
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA targeting alpha satellites on human chromosome 9
  • gRNA/shRNA sequence
    GTGGAATGGAATGGAATGGA
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The sgRNA against the alpha satellite sequence was cloned as described by Ma et al. 2015 "Multicolor CRISPR labeling of chromosomal loci in human cells"

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIN-U6-tracer_C9_1_-EF1a-Thy1.1-P2A-Neo was a gift from Albert Jeltsch (Addgene plasmid # 191397 ; http://n2t.net/addgene:191397 ; RRID:Addgene_191397)
  • For your References section:

    Modular fluorescence complementation sensors for live cell detection of epigenetic signals at endogenous genomic sites. Lungu C, Pinter S, Broche J, Rathert P, Jeltsch A. Nat Commun. 2017 Sep 21;8(1):649. doi: 10.1038/s41467-017-00457-z. 10.1038/s41467-017-00457-z PubMed 28935858