pHAGE-TO-Sp dCas9-mVenusN
(Plasmid #191396)

• Purpose: SpdCas9 fused to N-terminal part of mVenus
• Depositing Lab: Albert Jeltsch
• Publication: Lungu et al Nat Commun. 2017 Sep 21;8(1):649. doi: 10.1038/s41467-017-00457-z.

Backbone

• Vector backbone: pHAGE-TO-Sp dCas9
• Backbone size w/o insert (bp): 10740
• Total vector size (bp): 11430
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: N-terminal part of split mVenus
• Insert Size (bp): 689
• Promoter: CMV

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG

Resource Information

• Supplemental Documents:
  • pHAGE-TO-Sp dCas9-mVenusN.gb
• A portion of this plasmid was derived from a plasmid made by: The dCas9-based anchor module was derived from the pHAGE-TO-dCas9- 3XmCherry plasmid (provided by Dr Thoru Pederson, Addgene plasmid no. 64108)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry