Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSLIK-Rbfox2-rABE-Flag
(Plasmid #191384)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191384 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSLIK
  • Backbone size w/o insert (bp) 12648
  • Total vector size (bp) 14658
  • Vector type
    Lentiviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rbfox2-rABE
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
    1959
  • Entrez Gene
    RBFOX2 (a.k.a. FOX2, Fox-2, HNRBP2, HRNBP2, RBM9, RTA, dJ106I20.3, fxh)
  • Promoter tet-inducible promoter
  • Tag / Fusion Protein
    • Flag (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tcagatcgccactagtccaccatgttaattaaagcggagggcgcc
  • 3′ sequencing primer gctgggtctagatatctcgagtcaCTTGTCATCGTCATCCTTGTAATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLIK-Rbfox2-rABE-Flag was a gift from Stephen Floor (Addgene plasmid # 191384 ; http://n2t.net/addgene:191384 ; RRID:Addgene_191384)
  • For your References section:

    RNA molecular recording with an engineered RNA deaminase. Lin Y, Kwok S, Hein AE, Thai BQ, Alabi Y, Ostrowski MS, Wu K, Floor SN. Nat Methods. 2023 Dec;20(12):1887-1899. doi: 10.1038/s41592-023-02046-z. Epub 2023 Oct 19. 10.1038/s41592-023-02046-z PubMed 37857907