pSLIK-Rbfox2-rABE-Flag
(Plasmid
#191384)
-
PurposeDoxycycline inducible expression of Rbfox2-rABE
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191384 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSLIK
- Backbone size w/o insert (bp) 12648
- Total vector size (bp) 14658
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRbfox2-rABE
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1959
-
Entrez GeneRBFOX2 (a.k.a. FOX2, Fox-2, HNRBP2, HRNBP2, RBM9, RTA, dJ106I20.3, fxh)
- Promoter tet-inducible promoter
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcagatcgccactagtccaccatgttaattaaagcggagggcgcc
- 3′ sequencing primer gctgggtctagatatctcgagtcaCTTGTCATCGTCATCCTTGTAATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSLIK-Rbfox2-rABE-Flag was a gift from Stephen Floor (Addgene plasmid # 191384 ; http://n2t.net/addgene:191384 ; RRID:Addgene_191384) -
For your References section:
RNA molecular recording with an engineered RNA deaminase. Lin Y, Kwok S, Hein AE, Thai BQ, Alabi Y, Ostrowski MS, Wu K, Floor SN. Nat Methods. 2023 Dec;20(12):1887-1899. doi: 10.1038/s41592-023-02046-z. Epub 2023 Oct 19. 10.1038/s41592-023-02046-z PubMed 37857907