Skip to main content
Addgene

pQdC12a
(Plasmid #191356)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191356 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pQmod3C-GG
  • Backbone manufacturer
    Tolonen Lab
  • Backbone size w/o insert (bp) 4581
  • Total vector size (bp) 8290
  • Modifications to backbone
    PGusA2-TetO2/1 driving expression of dCas12a, miniPthl driving expression of tetR, gRNA cassette for dCas12a
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    Room Temperature
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PGusA2-TetO2/1-dCas12a (LbCpf1)
  • Species
    Synthetic
  • Insert Size (bp)
    3791
  • Promoter PGus2A-TetO2/1

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer caggaaacagctatgaccgc
  • 3′ sequencing primer cactgttatgccttttgact
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    miniPthl-tetR
  • Insert Size (bp)
    728
  • Promoter miniPthl

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer acaaggagtggctggagtac
  • 3′ sequencing primer ggaagattcgatcgctatgct
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cas12a (LbCpf1) cloned from Addgene 84740

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Clostridium CRISPRi plasmid with TetR-repressible dCas12a (LbCpf1) expression

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQdC12a was a gift from Andrew Tolonen (Addgene plasmid # 191356 ; http://n2t.net/addgene:191356 ; RRID:Addgene_191356)
  • For your References section:

    Tuning of Gene Expression in Clostridium phytofermentans Using Synthetic Promoters and CRISPRi. Rostain W, Zaplana T, Boutard M, Baum C, Tabuteau S, Sanitha M, Ramya M, Guss A, Ettwiller L, Tolonen AC. ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25. 10.1021/acssynbio.2c00385 PubMed 36427328