pQnl_tet
(Plasmid
#191355)
-
PurposeClostridium expression vector with TetR-repressed NanoLuc expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQmod2E-GG (Addgene 191345)
-
Backbone manufacturerTolonen Lab
- Backbone size w/o insert (bp) 5471
-
Modifications to backboneInserted PGusA2-TetO2/1-Nanoluc, miniPthl-tetR cassette
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePGusA2-TetO2/1-Nanoluc, miniPthl-tetR cassette
-
SpeciesSynthetic
-
Insert Size (bp)1383
- Promoter PGus2A-TetO2/1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer CAGGAAACAGCTATGACCGC
- 3′ sequencing primer GCTAAGGATTCAGAACGGCG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPromega
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQnl_tet was a gift from Andrew Tolonen (Addgene plasmid # 191355 ; http://n2t.net/addgene:191355 ; RRID:Addgene_191355) -
For your References section:
Tuning of Gene Expression in Clostridium phytofermentans Using Synthetic Promoters and CRISPRi. Rostain W, Zaplana T, Boutard M, Baum C, Tabuteau S, Sanitha M, Ramya M, Guss A, Ettwiller L, Tolonen AC. ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25. 10.1021/acssynbio.2c00385 PubMed 36427328