pQnl_Pcphy23
(Plasmid
#191354)
-
PurposeClostridium plasmid expressing NanoLuc reporter from moderate, constitutive promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191354 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepQexp
-
Backbone manufacturerPMID 19775243
- Backbone size w/o insert (bp) 6972
- Total vector size (bp) 5776
-
Modifications to backboneStrong, constitutive Clostridium phytofermentans promoter (Pcons17) driving expression of NanoLuc reporter
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePcphy23-NanoLuc
-
SpeciesSynthetic
-
Insert Size (bp)589
- Promoter Pcphy23
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer TTACCGCCTTTGAGTGAGCT
- 3′ sequencing primer TTGCTTCTAAGGTCGACGGA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPromega
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQnl_Pcphy23 was a gift from Andrew Tolonen (Addgene plasmid # 191354 ; http://n2t.net/addgene:191354 ; RRID:Addgene_191354) -
For your References section:
Tuning of Gene Expression in Clostridium phytofermentans Using Synthetic Promoters and CRISPRi. Rostain W, Zaplana T, Boutard M, Baum C, Tabuteau S, Sanitha M, Ramya M, Guss A, Ettwiller L, Tolonen AC. ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25. 10.1021/acssynbio.2c00385 PubMed 36427328