pQmod3S-GG
(Plasmid
#191349)
-
PurposeClostridium expression vector (pCB102 origin, specR) with drop-out Plac-RFP cassette flanked with BsaI sites
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191349 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMTL83341
-
Backbone manufacturerChain Biotech
- Backbone size w/o insert (bp) 3981
- Total vector size (bp) 4849
-
Modifications to backbonedrop-out Plac-RFP cassette flanked with BsaI sites
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePlac-RFP (IPTG-inducible red fluorescent protein)
-
Insert Size (bp)1103
- Promoter Plac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer caggaaacagctatgaccgc
- 3′ sequencing primer cactgttatgccttttgact (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQmod3S-GG was a gift from Andrew Tolonen (Addgene plasmid # 191349 ; http://n2t.net/addgene:191349 ; RRID:Addgene_191349) -
For your References section:
Tuning of Gene Expression in Clostridium phytofermentans Using Synthetic Promoters and CRISPRi. Rostain W, Zaplana T, Boutard M, Baum C, Tabuteau S, Sanitha M, Ramya M, Guss A, Ettwiller L, Tolonen AC. ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25. 10.1021/acssynbio.2c00385 PubMed 36427328