pQmod3E-GG
(Plasmid #191348)

• Purpose: Clostridium expression vector (pCB102 origin, ermR) with drop-out Plac-RFP cassette flanked with BsaI sites
• Depositing Lab: Andrew Tolonen
• Publication: Rostain et al ACS Synth Biol. 2022 Dec 16;11(12):4077-4088. doi: 10.1021/acssynbio.2c00385. Epub 2022 Nov 25.

Backbone

• Vector backbone: pMTL83241
• Backbone manufacturer: Chain Biotech
• Backbone size w/o insert (bp): 3823
• Total vector size (bp): 4693
• Modifications to backbone: drop-out Plac-RFP cassette flanked with BsaI sites
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Erythromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Plac-RFP (IPTG-inducible red fluorescent protein)
• Insert Size (bp): 1103
• Promoter: Plac

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SacI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: caggaaacagctatgaccgc
• 3′ sequencing primer: cactgttatgccttttgact

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry