Skip to main content
Addgene

mARGAna (cassette 2)
(Plasmid #191342)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191342 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    PB-CMV-MCS-EF1α-GFP
  • Backbone manufacturer
    System Biosciences
  • Backbone size w/o insert (bp) 6609
  • Total vector size (bp) 8142
  • Modifications to backbone
    Deleted CMV promotor and MCS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mARGAna (cassette 2)
  • Alt name
    Second-generation mammalian acoustic reporter gene (cassette 2) on the piggyBac transposon plasmid
  • Species
    Anabaena flos-aquae (Dolichospermum flos-aquae) CCAP 1403/13F
  • Insert Size (bp)
    5997
  • Promoter TRE3GV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cacggccactagtTTCACTCGAGTTTAC
  • 3′ sequencing primer CTAGATTACAGCCACGGGGCCC
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mARGAna (cassette 2) was a gift from Mikhail Shapiro (Addgene plasmid # 191342 ; http://n2t.net/addgene:191342 ; RRID:Addgene_191342)

  • For your References section:

    Genomically mined acoustic reporter genes for real-time in vivo monitoring of tumors and tumor-homing bacteria. Hurt RC, Buss MT, Duan M, Wong K, You MY, Sawyer DP, Swift MB, Dutka P, Barturen-Larrea P, Mittelstein DR, Jin Z, Abedi MH, Farhadi A, Deshpande R, Shapiro MG. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01581-y. 10.1038/s41587-022-01581-y PubMed 36593411
Related items:
Commonly requested with: