Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTETDuet_G121VDHFR_R127ATS
(Plasmid #191303)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191303 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTET-duet
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    folA, thyA
  • Alt name
    DHFR
  • Alt name
    TS
  • Species
    E. coli
  • Mutation
    G121V DHFR, R127A TYMS
  • Promoter T7 (folA), Tet (thyA)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoNI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer _GGATCTCGACGCTCTCCCTT
  • 3′ sequencing primer _CCGCTGAGCAATAACTAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.05.28.542639 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTETDuet_G121VDHFR_R127ATS was a gift from Kimberly Reynolds (Addgene plasmid # 191303 ; http://n2t.net/addgene:191303 ; RRID:Addgene_191303)
  • For your References section:

    The genetic landscape of a metabolic interaction. Nguyen TN, Ingle C, Thompson S, Reynolds KA. Nat Commun. 2024 Apr 18;15(1):3351. doi: 10.1038/s41467-024-47671-0. 10.1038/s41467-024-47671-0 PubMed 38637543