LacZ_pHIVEGFP
(Plasmid
#191251)
-
PurposeExpresses LacZ in mammalian cells (used as a control)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191251 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHIV-EGFP
-
Backbone manufactureraddgene Plasmid #21373
- Backbone size w/o insert (bp) 6900
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLacZ
-
GenBank ID945006
- Promoter EF1alpha
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TGGAATTTGCCCTTTTTGAG
- 3′ sequencing primer AGGAACTGCTTCCTTCACGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LacZ_pHIVEGFP was a gift from Chen Davidovich (Addgene plasmid # 191251 ; http://n2t.net/addgene:191251 ; RRID:Addgene_191251) -
For your References section:
PALI1 facilitates DNA and nucleosome binding by PRC2 and triggers an allosteric activation of catalysis. Zhang Q, Agius SC, Flanigan SF, Uckelmann M, Levina V, Owen BM, Davidovich C. Nat Commun. 2021 Jul 28;12(1):4592. doi: 10.1038/s41467-021-24866-3. 10.1038/s41467-021-24866-3 PubMed 34321472