pSN-A112C-1A32
(Plasmid #191241)

• Purpose: Expresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of poly-Leu-1A32 and a His-tag, for fluorescent studies.
• Depositing Lab: Alessandro Senes
• Publication: Diaz Vazquez et al Biophys J. 2023 Jan 3;122(1):143-155. doi: 10.1016/j.bpj.2022.11.018. Epub 2022 Nov 12.

Backbone

• Vector backbone: pET-28
• Backbone size w/o insert (bp): 5206
• Total vector size (bp): 5860
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: nuc (nuclease A), HLA-A (HLAA) (predicted interfacial residues of the transmembrane domain in a poly-leu background)
• Species: H. sapiens (human); Staphylococcus aureus
• Insert Size (bp): 654
• Mutation: Changed Alanine 112 to Cysteine in SN, and predicted interfacial residues of the transmembrane domain are in a poly-leu background
• GenBank ID: P10314 (P04439) P00644
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • nuclease A from S. aureus fused to the poly-Leu TM domain of HLA-A. The construct has a c-terminal His-tag for purification.

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: taatacgactcactataggg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2022.07.11.499632 for bioRxiv preprint.