Sandgrouse+R111Q–insD
(Plasmid
#191229)
-
PurposeExpresses Na,K-ATPase (ATP1A1 and ATP1B1 in pFastBac Dual vector) in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191229 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFastBac Dual
- Backbone size w/o insert (bp) 5238
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameATP1A1
-
SpeciesPterocles gutturalis
-
Insert Size (bp)3069
-
Mutationremoved aspartic acid at 121 and replaced arginine at 128 with glutamine in the protein sequence the protein sequence
-
GenBank IDXM_010081314
- Promoter PH
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTCCGGATTATTCATACCGTCCCACCATCG
- 3′ sequencing primer GTGGTATGGCTGATTATGATCCTCTAGTACTTCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameATP1B1
-
SpeciesPterocles gutturalis
-
Insert Size (bp)916
-
GenBank IDXM_010078905
- Promoter p10
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site PaeI (unknown if destroyed)
- 5′ sequencing primer CGGGTTCCTTCCGGTATTGTCTCCTTC
- 3′ sequencing primer ACGGACCTTTAATTCAACCCAACACAATATA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Sandgrouse+R111Q–insD was a gift from Susanne Dobler (Addgene plasmid # 191229 ; http://n2t.net/addgene:191229 ; RRID:Addgene_191229) -
For your References section:
Epistatic effects between amino acid insertions and substitutions mediate toxin-resistance of vertebrate Na+, K+-ATPases. Mohammadi S, Ozdemir HI, Ozbek P, Sumbul F, Stiller J, Deng Y, Crawford AJ, Rowland HM, Storz JF, Andolfatto P, Dobler S. Mol Biol Evol. 2022 Dec 6:msac258. doi: 10.1093/molbev/msac258. 10.1093/molbev/msac258 PubMed 36472530