pAAV-CAG-hfYFP
(Plasmid
#191201)
-
PurposeConstitutive CAG-driven expression of hfYFP in animals using AAV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerScott Sternson
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHyperfolder YFP
-
Alt namehfYFP
-
SpeciesSynthetic
-
Insert Size (bp)720
-
MutationmGreenLantern-F46L/C48S/V68L/A69M/C70V/K101E/T105Y/K149N/T167I/H203Y/K206V/D234N
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site Bsp1407I (not destroyed)
- 5′ sequencing primer pCAG-F (GCAACGTGCTGGTTATTGTG)
- 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Constitutive expression
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-hfYFP was a gift from Gregory Petsko (Addgene plasmid # 191201 ; http://n2t.net/addgene:191201 ; RRID:Addgene_191201) -
For your References section:
Chemically stable fluorescent proteins for advanced microscopy. Campbell BC, Paez-Segala MG, Looger LL, Petsko GA, Liu CF. Nat Methods. 2022 Nov 7. pii: 10.1038/s41592-022-01660-7. doi: 10.1038/s41592-022-01660-7. 10.1038/s41592-022-01660-7 PubMed 36344833