placZα-tdMCP
(Plasmid
#191132)
-
PurposeExpression of tdMCP from a lacZα inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191132 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSB1A3
-
Backbone manufactureriGEM part registry, 2017 Distribution
- Backbone size w/o insert (bp) 2618
- Total vector size (bp) 3398
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namedMCP_1
-
Alt nametdMCP
-
Alt namedMCP
-
Alt nametandem dimer MCP
-
SpeciesSynthetic
- Promoter lac-inducible promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tgccacctgacgtctaagaa (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
placZα-tdMCP was a gift from Ariel Lindner (Addgene plasmid # 191132 ; http://n2t.net/addgene:191132 ; RRID:Addgene_191132) -
For your References section:
Spatial engineering of E. coli with addressable phase-separated RNAs. Guo H, Ryan JC, Song X, Mallet A, Zhang M, Pabst V, Decrulle AL, Ejsmont P, Wintermute EH, Lindner AB. Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016. 10.1016/j.cell.2022.09.016 PubMed 36179672