prCAG-MS2
(Plasmid
#191121)
-
PurposeTranscription of 47xCAG and 12xMS2 repeats from a tetracycline-inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR-Tre3G-47xCAG-12xMS2
- Backbone size w/o insert (bp) 3287
- Total vector size (bp) 4103
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namerCAG
-
Alt namerCAGx47
-
Alt nameCAG
-
Alt nameCAGx47
-
SpeciesSynthetic
-
Insert Size (bp)141
- Promoter Tet
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer AGGCTGCTCTACACCTAGCT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameMS2
-
Alt nameMS2x12
-
SpeciesSynthetic
-
Insert Size (bp)603
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
prCAG-MS2 was a gift from Ariel Lindner (Addgene plasmid # 191121 ; http://n2t.net/addgene:191121 ; RRID:Addgene_191121) -
For your References section:
Spatial engineering of E. coli with addressable phase-separated RNAs. Guo H, Ryan JC, Song X, Mallet A, Zhang M, Pabst V, Decrulle AL, Ejsmont P, Wintermute EH, Lindner AB. Cell. 2022 Sep 29;185(20):3823-3837.e23. doi: 10.1016/j.cell.2022.09.016. 10.1016/j.cell.2022.09.016 PubMed 36179672