pAAV-CAG-UnaG-P2A-FusionRed
(Plasmid #191109)

• Purpose: Mammalian cell line expression plasmids for production of UnaG and FusionRed proteins
• Depositing Lab: Kiryl Piatkevich
• Publication: Liang et al Front Bioeng Biotechnol. 2022 Oct 17;10:1039317. doi: 10.3389/fbioe.2022.1039317. eCollection 2022.

Backbone

• Vector backbone: pAAV-CAG
• Backbone size w/o insert (bp): 5515
• Total vector size (bp): 5932
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UnaG
• Species: Anguilla japonica
• Insert Size (bp): 417
• Mutation: See depositor comments below
• GenBank ID: AB763906.1
• Promoter: chicken β-actin promoter
• Tag / Fusion Protein:
  • FusionRed (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (unknown if destroyed)
• 3′ cloning site: AgeI (unknown if destroyed)
• 5′ sequencing primer: TCTTCTTTTTCCTACAGCTC
• 3′ sequencing primer: ATCAAGCTTATCGATaatca

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: The plasmid contains a 149bp deletion that removes part of the 2nd ITR. This deletion is not expected to affect plasmid function.