pAAV-CAG-EGFP-P2A-FusionRed
(Plasmid
#191108)
-
PurposeMammalian cell line expression plasmids for production of EGFP and FusionRed proteins
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 191108 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CAG
- Backbone size w/o insert (bp) 5515
- Total vector size (bp) 6232
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepAAV-CAG-EGFP-P2A-FusionRed
-
SpeciesAequorea victoria
-
Insert Size (bp)717
-
MutationSee depositor comments below
-
GenBank IDAAB02572.1
- Promoter chicken β-actin promoter
-
Tag
/ Fusion Protein
- FusionRed (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site AgeI (unknown if destroyed)
- 5′ sequencing primer CAAAGAATTGGATCCGGTACCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCA
- 3′ sequencing primer CCACTTCCCACGTGAACCGGTCGCTTGTACAGCTCGTCCATGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: The plasmid contains a 149bp deletion that removes part of the 2nd ITR. This deletion is not expected to affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-EGFP-P2A-FusionRed was a gift from Kiryl Piatkevich (Addgene plasmid # 191108 ; http://n2t.net/addgene:191108 ; RRID:Addgene_191108) -
For your References section:
Enhanced small green fluorescent proteins as a multisensing platform for biosensor development. Liang GT, Lai C, Yue Z, Zhang H, Li D, Chen Z, Lu X, Tao L, Subach FV, Piatkevich KD. Front Bioeng Biotechnol. 2022 Oct 17;10:1039317. doi: 10.3389/fbioe.2022.1039317. eCollection 2022. 10.3389/fbioe.2022.1039317 PubMed 36324888