Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-NRCH-PE2max-BSD
(Plasmid #191103)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 191103 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-PE2max-BSD
  • Backbone manufacturer
    Hyongbum Kim
  • Backbone size w/o insert (bp) 8693
  • Total vector size (bp) 15050
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NRCH-PEmax
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6357
  • Mutation
    Changed R221K, N394K, H840A from SpCas9-NRCH
  • Promoter EF-1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTAAACTGGGAAAGTGATGTCGTGT
  • 3′ sequencing primer ggttgcgtcagcaaacacag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-NRCH-PE2max-BSD was a gift from Hyongbum Kim (Addgene plasmid # 191103 ; http://n2t.net/addgene:191103 ; RRID:Addgene_191103)
  • For your References section:

    Prediction of efficiencies for diverse prime editing systems in multiple cell types. Yu G, Kim HK, Park J, Kwak H, Cheong Y, Kim D, Kim J, Kim J, Kim HH. Cell. 2023 Apr 21:S0092-8674(23)00331-8. doi: 10.1016/j.cell.2023.03.034. 10.1016/j.cell.2023.03.034 PubMed 37119812