pcDNA-EGFP MASTL WT (siRNA resistant)
(Plasmid #191011)

• Purpose: Expresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)
• Depositing Lab: Johanna Ivaska
• Publication: Taskinen et al J Cell Biol. 2020 Jun 1;219(6). pii: 151688. doi: 10.1083/jcb.201906204.

Backbone

• Vector backbone: pEGFP-C2
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4735
• Total vector size (bp): 7356
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Microtubule-associated serine/threonine kinase like
• Species: H. sapiens (human)
• GenBank ID: 84930
• Entrez Gene: MASTL (a.k.a. GREATWALL, GW, GWL, MAST-L, THC2)
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: EGFP_C
• 3′ sequencing primer: SV40pA_R

Resource Information

• Supplemental Documents:
  • pcDNA-EGFP MASTL WT (siRNA resistant).gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry