pET-Duet1_6xHis-TEV-eGFP-P62
(Plasmid
#190929)
-
PurposePlasmid for the expression and purification of GFP labelled p62. Internal reference: SMC390
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET-Duet1
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 7472
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameP62
-
Alt nameA170
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2086
-
GenBank IDNC_000005.10
-
Entrez GeneSQSTM1 (a.k.a. A170, DMRV, EBIAP, FTDALS3, NADGP, OSIL, PDB3, ZIP3, p60, p62, p62B)
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATCACCATCATCACCAC
- 3′ sequencing primer ATGTATATCTCCTTCTTATACTTAACTAATATACTAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-Duet1_6xHis-TEV-eGFP-P62 was a gift from Sascha Martens (Addgene plasmid # 190929 ; http://n2t.net/addgene:190929 ; RRID:Addgene_190929) -
For your References section:
Reconstitution defines the roles of p62, NBR1 and TAX1BP1 in ubiquitin condensate formation and autophagy initiation. Turco E, Savova A, Gere F, Ferrari L, Romanov J, Schuschnig M, Martens S. Nat Commun. 2021 Sep 1;12(1):5212. doi: 10.1038/s41467-021-25572-w. 10.1038/s41467-021-25572-w PubMed 34471133