Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFastBac_HT_B_6xHis-TEV-GFP-NBR1
(Plasmid #190928)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190928 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFastBac_HT_B
  • Backbone manufacturer
    Thermofisher Scientific
  • Backbone size w/o insert (bp) 4856
  • Total vector size (bp) 8562
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NBR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3716
  • GenBank ID
    NC_000017.11
  • Entrez Gene
    NBR1 (a.k.a. 1A1-3B, IAI3B, M17S2, MIG19)
  • Tag / Fusion Protein
    • Strep-TEV-GFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GTCGCATCCGCAGTTCGAG
  • 3′ sequencing primer TCAATAGCGTTGGCTGTACCAGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFastBac_HT_B_6xHis-TEV-GFP-NBR1 was a gift from Sascha Martens (Addgene plasmid # 190928 ; http://n2t.net/addgene:190928 ; RRID:Addgene_190928)
  • For your References section:

    Reconstitution defines the roles of p62, NBR1 and TAX1BP1 in ubiquitin condensate formation and autophagy initiation. Turco E, Savova A, Gere F, Ferrari L, Romanov J, Schuschnig M, Martens S. Nat Commun. 2021 Sep 1;12(1):5212. doi: 10.1038/s41467-021-25572-w. 10.1038/s41467-021-25572-w PubMed 34471133