pYTK001_O2Aq(2nd)
(Plasmid
#190918)
-
Purpose2A peptide O2A cloned in yeast MoClo entry vector (pYTK001) for use as the second 2A peptide in quad-cistronic construct assembly
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190918 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepYTK001
-
Backbone manufacturerJohn Deuber
- Backbone size w/o insert (bp) 1663
- Total vector size (bp) 1726
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameO2A
-
Alt nameOperophtera brumata cypovirus 18
-
Insert Size (bp)63
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CCTTTTTACGGTTCCTGGCC
- 3′ sequencing primer CTTGGACTCCTGTTGATAGATCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene plasmid #65108
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYTK001_O2Aq(2nd) was a gift from Zhen Wang (Addgene plasmid # 190918 ; http://n2t.net/addgene:190918 ; RRID:Addgene_190918) -
For your References section:
A Well-Characterized Polycistronic-Like Gene Expression System in Yeast. Mukherjee M, Wang ZQ. Biotechnol Bioeng. 2022 Sep 27. doi: 10.1002/bit.28247. 10.1002/bit.28247 PubMed 36168285