pAAVss-U6-sgHTT51-7sk-Cas9
(Plasmid
#190901)
-
PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 190901 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAAVss
- Backbone size w/o insert (bp) 3509
- Total vector size (bp) 4379
-
Vector typeAAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequencemouse HTT and spCas9
-
SpeciesM. musculus (mouse)
-
Entrez GeneHtt (a.k.a. C430023I11Rik, Hd, Hdh, IT15)
- Promoter U6 and 7sk
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGACTATCATATGCTTACCGTAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAVss-U6-sgHTT51-7sk-Cas9 was a gift from Nicole Déglon (Addgene plasmid # 190901 ; http://n2t.net/addgene:190901 ; RRID:Addgene_190901) -
For your References section:
Semi-automated workflows to quantify AAV transduction in various brain areas and predict gene editing outcome for neurological disorders. Duarte F, Ramosaj M, Hasanovic E, Regio S, Sipion M, Rey M, Deglon N. Mol Ther Methods Clin Dev. 2023 Mar 27;29:254-270. doi: 10.1016/j.omtm.2023.03.013. eCollection 2023 Jun 8. 10.1016/j.omtm.2023.03.013 PubMed 37090478